FES1

I have found a sequence structure below in FES1 genome so far.

$ bwa index -p egfp_index egfp.fasta
$ bwa mem egfp_index DRR028646_1.fasta | grep EGFP > DRR028646_1_egfp.sam
$ bwa index -p caggs_index caggs.fasta
$ bwa mem caggs_index DRR028646_1.fasta | grep caggs > DRR028646_1_caggs.sam
$ bwa index -p rabbit-pA_index rabbit-pA.fasta
$ bwa mem rabbit-pA_index DRR028646_1.fasta | grep rabbit-pA > DRR028646_1_rabbit-pA.sam
$
$ samtools view -bS rabbit-pA.sam > rabbit-pA.bam
$ #v0.1.19
$ samtools sort rabbit-pA.bam rabbit-pA
$ #v1.3.1, and use .sort.bam file instead of .bam file
$ samtools sort rabbit-pA.bam -o rabbit-pA.sort.bam
$ samtools index rabbit-pA.bam
$ samtools tview rabbit-pA.bam ../../transgene/rabbit-pA.fasta
$
$ samtools mpileup -uf ../../transgene/rabbit-pA.fasta rabbit-pA.bam | bcftools view -vcg - > rabbit-pA.vcf
 
alignment on this tail-to-tail structure

the number of coverages of transgene sequences by DRR028646_1.fastq

integration site of the transgene (1)

in mouse chromosome 3, position 37732943

I found this site by mapping mate pair reads of the reads that were aligned on rabbit globin pA sequence as below.

$ samtools view -h DRR028646_1_rabbit-pA.bam | grep -v "^@" | cut -f 1 > DRR028646_1_rabbit-pA.read_id
$ sed -e "s/^/^@/" -e "s/$/\\\s/" DRR028646_1_rabbit-pA.read_id > DRR028646_1_rabbit-pA.read_id.pattern
$ zgrep -A3 -f DRR028646_1_rabbit-pA.read_id.pattern DRR028646_2.fastq.gz > DRR028646_2_1-rabbit-pA.fastq
$ grep -v "^--" DRR028646_2_1-rabbit-pA.fastq > temp
$ mv temp DRR028646_2_1-rabbit-pA.fastq
$ bwa mem ../../genome/GRCm38_index DRR028646_2_1-rabbit-pA.fastq > DRR028646_2_1-rabbit-pA.sam
$ samtools view -bS DRR028646_2_1-rabbit-pA.sam > DRR028646_2_1-rabbit-pA.bam
$ samtools sort DRR028646_2_1-rabbit-pA.bam DRR028646_2_1-rabbit-pA
$ samtools index DRR028646_2_1-rabbit-pA.bam
$ samtools tview DRR028646_2_1-rabbit-pA.bam ../../genome/Mus_musculus.GRCm38.74.dna.toplevel.fa

then do the command g and type 3:37733000.

integration site of the transgene (2)

I found that two reads from DRR028646_1.fastq contain the boundery between rabbit polyA sequence and mouse chromosome 3.

CTAGCCAGATTTTTCCTCCTCTCCTGACTACTCCCAGTCATAGCTGTCCCTCTTC|CACTGTGCCCGTGGGTGCTGGGGTGGAAGGGCCATGCTTGTCCAGAGCACAATTCCTCCACCAAAGCTATGCCTTTCCGAATGACTTCTGCCTTAT

TTTTTATGTTTTGTTTTGTGTTATTTTTTTCTTTAACATCCCTAAAATTTTCCTTACATGTTTTACTAGCCAGATTTTTCCTCATCTCCTGACTACTCCCAGTCATAGCTGTCCCTCTTC|CACTGTGCCCGTGGGTGCTGGGGTGGAAGGG	

Some of the other reads have HindIII-BamHI region from rabbit pA sequence from pCAGGS. But above two sequence have no such region. Thus I speculated that the right end (on the reference genome) of transgene(s) in the chromosome 3 is Acr3-GFP.

integration site of the transgene (3)

I searched the other end of the integration site. From the analysis (1) and (2), I know an integration site reside around 3:37732943. Next I searched reads that are aligned on left 1kb region of the integration site, i.e. 3:37731943-37732943.

$ samtools faidx ../../genome/Mus_musculus.GRCm38.74.dna.toplevel.fa 3:37731943-37732943 > ../../genome/chr3_37731943-37732943.fasta

$ samtools index -p ../../genome/chr3_37731943-37732943_index ../../genome/chr3_37731943-37732943.fasta

... not found